Part:BBa_K4811007

TMS(Kan1)

This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, developed by Paul et al. It is a trans-encoded genetic switch, which binds to the Ribosome Binding Site (RBS) BBa_K4811000, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.

In this particular part, the D-loop of BBa_K4811002 has been exchanged for a Kanamycin-sensitive aptamer, with the sequence: GGGAGCTCGGTACCGAATTCTC

The aptamer is from Kwon et al (see Design).

Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions, the color denotes the probability of being unpaired. Using the following parameters: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007) Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011. Sequence and Features BBa_K4811007 SequenceAndFeatures